Listeria monocytogenes non-coding RNA

Listeria snRNA rli22

Predicted secondary structure of Listeria snRNA rli22
Identifiers
Symbol	rli22
Rfam	RF01457
Other data
RNA type	gene, snRNA
Domain(s)	Listeria

Listeria monocytogenes is a gram positive bacterium and causes many food-borne infections such as Listeriosis. This bacteria is ubiquitous in the environment where it can act as either a saprophyte when free living within the environment or as a pathogen when entering a host organism. Many non-coding RNAs have been identified within the bacteria genome where several of these have been classified as novel non-coding RNAs and may contribute to pathogenesis.^[1]

Tiling arrays and mutagenesis identified many non-coding RNAs within the L. monocytogenes genome and the location of these non-coding RNAs within the bacterial genome was confirmed by RACE (rapid amplification of cDNA ends) analysis. These studies showed that the expression of many non-coding RNAs was dependent on the environment and that several of these non-coding RNAs act as cis-regulatory elements. Comparisons between previously characterized non-coding RNAs and those present in the L. monocyotogenes genome identified 50 novel non-coding RNAs in L. monocyotogenes. An additional comparative study between the pathogenic L. monocytogenes strain and the non pathogenic L. innocua strain identified several non-coding RNAs that are only present within L. monocytogenes which suggests that these ncRNAs may have a role in pathogenesis.^[2] The tables below summarizes the location, flanking genes and also the characteristics of the novel small non-coding RNAs identified and the previously characterized non-coding RNAs present in L. monocytogenes

Novel Non-coding RNAs

ID	Start	Stop	Size	5' flanking gene	sense of the gene on the genome	^a		3' flanking gene	Characteristic
rli22	31997	32107	110	lmo0028	->	->	->	lmo0029	sRNA
rli23	172171	172268	97	lmo0172	<-	->			sRNA Antisense to lmo0172 transposase Homolog of rli25 and rli35.
rli24	271029	271186	157	lmo0256	->	->	->	lmo0257	sRNA
rli25	357618	357516	102	lmo0330	->	<-			sRNA Antisense to lmo0330: transposase. Homolog of rli23 and rli35
rli26	388707	388520	187	lmo0360	->	<-	<-	lmo0361	sRNA
rli27	434831	434929	98	lmo0411	<-	->	<-	lmo0412	sRNA
rli28	507394	507206	188	lmo0470	->	<-	->	lmo0471	sRNA Homolog of rli50
rli29	507643	507450	193	lmo0470	->	<-	->	lmo0471	sRNA Antisense to the 5'UTR of lmo0471
rli30	540785	540670	115	lmo0506	->	<-			sRNA Antisense to lmo0506
rli31	597812	597926	114	lmo0558	<-	->	->	lmo0559	Required for lysozyme resistance and pathogenesis.^[3] Structure characterized as two long hairpins. Interacts with the RNA binding global regulator SpoVG.^[4]
rli32	600750	600604	147	lmo0560	<-	<-	<-	lmo0561	sRNA
rli33	708326	708860	534	lmo0671	->	->	->	lmo0672	sRNA
rli34	803031	802948	83	lmo0777	->	<-	->	lmo0778	sRNA
rli35	855495	855393	102	lmo0828	->	<-			sRNA Antisense to lmo0828: transposase. Homolog of rli23 and rli25
rli36	859527	859444	83	nifJ	->	<-	<-	fbp	sRNA
rli37	907576	907832	256	lmo0866	->	->	->	lmo0867	ORF ORF of 58aa. RBS region: TGATACGGGAGTGTGGTGCTAGTTATG
rli38	1152549	1152917	369	lmo1115	<-	->	->	lmo1116	sRNA role in virulence
rli39	1179807	1179993	187	lmo1149	->	->	<-	lmo1150	sRNA Annotated as a cobalamin riboswitch in Rfam
rli40	1275810	1275547	264	lmo1251	->	<-	<-	lmo1252	ORF ORF of 64 aa. RBS region: AGTGAGGCGTCCTTATG
rli41	1277207	1276713	495	lmo1252	<-	<-	->	lmo1253	Two ORFs ORF of 45 aa. RBS region: AGAGGAGGTATTTTCTATG ORF of 35 aa. RBS region:AAGGAGGAAAACAAATTG
rli42	1399617	1399447	171	lmo1374	->	<-	->	lmo1375	sRNA
rli43	1861630	1861377	253	inlC	<-	<-	<-	rplS	ORF ORF of 35aa. RBS region: AGAGTGAGGTGTAATATG
rli44	2039087	2039375	289	lmo1964	<-	->	<-	lmo1965	ORF ORF of 28aa. RBS region: GGAAAGGATAACCCATG
rli45	2154775	2154852	77	lmo2074	->	->	<-	lmo2075	sRNA Antisense to rli46
rli46	2155058	2154765	294	lmo2074	->	<-	<-	lmo2075	sRNA Antisense to rli45
rli47	2226024	2226532	508	lmo2141	->	->	<-	lmo2142	sRNA
rli48	2361423	2361274	149	lmo2271	<-	<-	->	lmo2272	sRNA
rli49	2660179	2660364	185	lmo2579	->	->	<-	lmo2580	sRNA
rli50	2783274	2783098	176	lmo2709	->	<-	<-	lmo2710	sRNA Homolog of rli28
rli51	207589	207709	120	hly	->	->	->	mpl	5'-UTR-derived Increased in intestinal lumen
rli52	552421	552327	94	lmo0517	<-	<-	<-	lmo0518	5'-UTR-derived Putative riboswitch.
rli53	955829	956001	172	lmo0918	->	->	->	lmo0919	5'-UTR-derived Putative riboswitch.
rli54	1078584	1079111	527	lmo1051	<-	->	->	pdhA	5'-UTR-derived Putative riboswitch.
rli55	1198107	1198389	282	lmo1170	->	->	->	pduQ	5'-UTR-derived Putative riboswitch.
rli56	1199859	1199958	99	pduQ	->	->	->	lmo1172	5'-UTR-derived Putative riboswitch.
rli57	?	1216658	?	lmo1190	->	->	->	cbiA	3'-UTR-derived Annotated as a cobalamin riboswitch in Rfam lmo1190-rli57 transcript levelncreasedinintestinal lumen
rli58	?	1639974	?	rpsD	->	<-	<-	lmo1597
rli59	1702553	1702373	180	lmo1652	<-	<-	<-	lmo1653	5'-UTR-derived
rli60	2054124	2054308	184	lmo1982	<-	->	->	ilvD	5'-UTR-derived Putative riboswitch.
rli61	2275363	2275258	106	lmo2187	<-	<-	<-	lmo2188	5'-UTR-derived Putative riboswitch
rli62	2364508	2364337	172	lmo2277	<-	<-	<-	lmo2278	5'-UTR-derived Putative riboswitch.
rli63	2613301	?	?	atpI	<-	<-	<-	lmo2537	5'-UTR-derived Putative riboswitch
rliA	513584	513807	224	lmo0476	<-	>-	>-	lmo0477	snRNA
rliB	544357	544716	360	lmo0509	->	->	->	lmo0510	sRNA
rliC	1154309	1154671	363	lmo1117	->	->	<-	lmo1118	sRNA
rliD	1359529	1359202	328	rpsO	->	<-	->	pnpA	sRNA antisense
rliE	1584586	1584808	223	comC	<-	->	<-	folC	sRNA antisense to comC mRNA
rliF	2106292	2106073	220	nadA	->	<-	<-	lmo2026	snRNA
rliG	2386992	2386715	278	lmo2302	<-	<-	<-	lmo2303	sRNA
rliH	1180826	1181254	429	lmo1150	<-	->	->	lmo1151	sRNA antisense
rliI	2842200	2841962	239	lmo2760	<-	<-	->	lmo2761	sRNA
sbrA^[5]	1399363	1399433	70	lmo1374	->	->	->	lmo1375	sRNA

^aArrows indicate the sense of the gene on the genome. Bold arrows indicate gene absent from L. innocua.

Listeria monocytogenes EGD-e strain was used in these studies EMBL accession AL591824.1

Characterised non-coding RNAs

ID	Rfam	ID	Rfam
SAM	RF00162	PrfA	RF00038
LhrC	RF00616	L10 leader	RF00557
TPP	RF00059	Purine	RF00167
glmS	RF00234	lysine	RF00168
PreQ1	RF00522	yybP-ykoY	RF00080
T-box	RF00230	glycine	RF00504
SsrS	RF00013	L21	RF00559
LhrB	RF00558	RyrR	RF00515
FMN	RF00050	LhrA	RF00615
ssrA	RF00023	L13	RF00555
SRP	RF00169

References

↑ Mandin P, Repoila F, Vergassola M, Geissmann T, Cossart P (2007). "Identification of new noncoding RNAs in Listeria monocytogenes and prediction of mRNA targets". Nucleic Acids Res. 35 (3): 962–74. doi:10.1093/nar/gkl1096. PMC 1807966. PMID 17259222.
↑ Toledo-Arana A, Dussurget O, Nikitas G, et al. (June 2009). "The Listeria transcriptional landscape from saprophytism to virulence". Nature. 459 (7249): 950–6. doi:10.1038/nature08080. PMID 19448609.
↑ Burke TP, Loukitcheva A, Zemansky J, Wheeler R, Boneca IG, Portnoy DA (2014). "Listeria monocytogenes is resistant to lysozyme through the regulation, not the acquisition, of cell wall-modifying enzymes". J Bacteriol. 196 (21): 3756–67. doi:10.1128/JB.02053-14. PMC 4248804. PMID 25157076.
↑ Burke TP, Portnoy DA (2016). "SpoVG Is a Conserved RNA-Binding Protein That Regulates Listeria monocytogenes Lysozyme Resistance, Virulence, and Swarming Motility". Mbio. 7 (2). doi:10.1128/mBio.00240-16. PMC 4959528. PMID 27048798.
↑ Nielsen JS, Olsen AS, Bonde M, Valentin-Hansen P, Kallipolitis BH (2008). "Identification of a sigma B-dependent small noncoding RNA in Listeria monocytogenes.". J Bacteriol. 190 (18): 6264–70. doi:10.1128/JB.00740-08. PMC 2546787. PMID 18621897.

External links

Rfam database

Gallery of secondary structure images

Listeria snRNA rli22: Predicted secondary structure taken from the Rfam database. Family RF01457.

Listeria snRNA rli23: Predicted secondary structure taken from the Rfam database. Family RF01458.

Listeria snRNA rliE: Predicted secondary structure taken from the Rfam database. Family RF01459.

Listeria snRNA rliH: Predicted secondary structure taken from the Rfam database. Family RF01460.

Listeria snRNA rli24: Predicted secondary structure taken from the Rfam database. Family RF01461.

Listeria snRNA rli26: Predicted secondary structure taken from the Rfam database. Family RF01462.

Listeria snRNA rli27: Predicted secondary structure taken from the Rfam database. Family RF01463.

Listeria snRNA rliA: Predicted secondary structure taken from the Rfam database. Family RF01464.

Listeria snRNA rli31: Predicted secondary structure taken from the Rfam database. Family RF01465.

Listeria snRNA rli34: Predicted secondary structure taken from the Rfam database. Family RF01466.

Listeria snRNA rli36: Predicted secondary structure taken from the Rfam database. Family RF01467.

Listeria snRNA rli32: Predicted secondary structure taken from the Rfam database. Family RF01468.

Listeria snRNA rli33: Predicted secondary structure taken from the Rfam database. Family RF01469.

Listeria snRNA rli38: Predicted secondary structure taken from the Rfam database. Family RF01470.

Listeria snRNA rliB: Predicted secondary structure taken from the Rfam database. Family RF01471.

Listeria snRNA rli40: Predicted secondary structure taken from the Rfam database. Family RF01472.

Listeria snRNA rli41: Predicted secondary structure taken from the Rfam database. Family RF01473.

Listeria snRNA rli42: Predicted secondary structure taken from the Rfam database. Family RF01474.

Listeria snRNA rli45: Predicted secondary structure taken from the Rfam database. Family RF01475.

Listeria snRNA rliF: Predicted secondary structure taken from the Rfam database. Family RF01476.

Listeria snRNA rli43: Predicted secondary structure taken from the Rfam database. Family RF01477.

Listeria snRNA rli47: Predicted secondary structure taken from the Rfam database. Family RF01478.

Listeria snRNA rli48: Predicted secondary structure taken from the Rfam database. Family RF01479.

Listeria snRNA rli52: Predicted secondary structure taken from the Rfam database. Family RF01480.

Listeria snRNA rli53: Predicted secondary structure taken from the Rfam database. Family RF01481.

Listeria snRNA rli55: Predicted secondary structure taken from the Rfam database. Family RF01482.

Listeria snRNA rli56: Predicted secondary structure taken from the Rfam database. Family RF01483.

Listeria snRNA rli59: Predicted secondary structure taken from the Rfam database. Family RF01484.

Listeria snRNA rli61: Predicted secondary structure taken from the Rfam database. Family RF01485.

Listeria snRNA rli62: Predicted secondary structure taken from the Rfam database. Family RF01486.

Listeria snRNA rliI: Predicted secondary structure taken from the Rfam database. Family RF01487.

Listeria snRNA rli49: Predicted secondary structure taken from the Rfam database. Family RF01488.

Listeria snRNA sbrA: Predicted secondary structure taken from the Rfam database. Family RF01489.

Listeria snRNA rli51: Predicted secondary structure taken from the Rfam database. Family RF01490.

Listeria snRNA rli54: Predicted secondary structure taken from the Rfam database. Family RF01491.

Listeria snRNA rli28: Predicted secondary structure taken from the Rfam database. Family RF01492.

Listeria snRNA rli37: Predicted secondary structure taken from the Rfam database. Family RF01493.

Listeria sRNA rliD: Predicted secondary structure taken from the Rfam database. Family RF01494.

This article is issued from Wikipedia - version of the 9/15/2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.